Class | Bio::Sequence::NA |
In: |
lib/bio/sequence/compat.rb
lib/bio/sequence/na.rb |
Parent: | Object |
Bio::Sequence::NA represents a bare Nucleic Acid sequence in bioruby.
# Create a Nucleic Acid sequence. dna = Bio::Sequence.auto('atgcatgcATGCATGCAAAA') rna = Bio::Sequence.auto('augcaugcaugcaugcaaaa') # What are the names of all the bases? puts dna.names puts rna.names # What is the GC percentage? puts dna.gc_percent puts rna.gc_percent # What is the molecular weight? puts dna.molecular_weight puts rna.molecular_weight # What is the reverse complement? puts dna.reverse_complement puts dna.complement # Is this sequence DNA or RNA? puts dna.rna? # Translate my sequence (see method docs for many options) puts dna.translate puts rna.translate
Generate an nucleic acid sequence object from a string.
s = Bio::Sequence::NA.new("aagcttggaccgttgaagt")
or maybe (if you have an nucleic acid sequence in a file)
s = Bio::Sequence:NA.new(File.open('dna.txt').read)
Nucleic Acid sequences are always all lowercase in bioruby
s = Bio::Sequence::NA.new("AAGcTtGG") puts s #=> "aagcttgg"
Whitespace is stripped from the sequence
seq = Bio::Sequence::NA.new("atg\nggg\ttt\r gc") puts s #=> "atggggttgc"
Arguments:
Returns: | Bio::Sequence::NA object |
# File lib/bio/sequence/na.rb, line 77 77: def initialize(str) 78: super 79: self.downcase! 80: self.tr!(" \t\n\r",'') 81: end
Generate a new random sequence with the given frequency of bases. The sequence length is determined by their cumulative sum. (See also Bio::Sequence::Common#randomize which creates a new randomized sequence object using the base composition of an existing sequence instance).
counts = {'a'=>1,'c'=>2,'g'=>3,'t'=>4} puts Bio::Sequence::NA.randomize(counts) #=> "ggcttgttac" (for example)
You may also feed the output of randomize into a block
actual_counts = {'a'=>0, 'c'=>0, 'g'=>0, 't'=>0} Bio::Sequence::NA.randomize(counts) {|x| actual_counts[x] += 1} actual_counts #=> {"a"=>1, "c"=>2, "g"=>3, "t"=>4}
Arguments:
Returns: | Bio::Sequence::NA object |
# File lib/bio/sequence/compat.rb, line 83 83: def self.randomize(*arg, &block) 84: self.new('').randomize(*arg, &block) 85: end
Calculate the ratio of AT / ATGC bases. U is regarded as T.
s = Bio::Sequence::NA.new('atggcgtga') puts s.at_content #=> 0.444444444444444
Returns: | Float |
# File lib/bio/sequence/na.rb, line 319 319: def at_content 320: count = self.composition 321: at = count['a'] + count['t'] + count['u'] 322: gc = count['g'] + count['c'] 323: return 0.0 if at + gc == 0 324: return at.quo(at + gc) 325: end
Calculate the ratio of (A - T) / (A + T) bases. U is regarded as T.
s = Bio::Sequence::NA.new('atgttgttgttc') puts s.at_skew #=> -0.75
Returns: | Float |
# File lib/bio/sequence/na.rb, line 347 347: def at_skew 348: count = self.composition 349: a = count['a'] 350: t = count['t'] + count['u'] 351: return 0.0 if a + t == 0 352: return (a - t).quo(a + t) 353: end
Returns counts of each codon in the sequence in a hash.
s = Bio::Sequence::NA.new('atggcgtga') puts s.codon_usage #=> {"gcg"=>1, "tga"=>1, "atg"=>1}
This method does not validate codons! Any three letter group is a ‘codon’. So,
s = Bio::Sequence::NA.new('atggNNtga') puts s.codon_usage #=> {"tga"=>1, "gnn"=>1, "atg"=>1} seq = Bio::Sequence::NA.new('atgg--tga') puts s.codon_usage #=> {"tga"=>1, "g--"=>1, "atg"=>1}
Also, there is no option to work in any frame other than the first.
Returns: | Hash object |
# File lib/bio/sequence/na.rb, line 275 275: def codon_usage 276: hash = Hash.new(0) 277: self.window_search(3, 3) do |codon| 278: hash[codon] += 1 279: end 280: return hash 281: end
Example:
seq = Bio::Sequence::NA.new('gaattc') cuts = seq.cut_with_enzyme('EcoRI')
or
seq = Bio::Sequence::NA.new('gaattc') cuts = seq.cut_with_enzyme('g^aattc')
See Bio::RestrictionEnzyme::Analysis.cut
# File lib/bio/sequence/na.rb, line 481 481: def cut_with_enzyme(*args) 482: Bio::RestrictionEnzyme::Analysis.cut(self, *args) 483: end
Returns a new sequence object with any ‘u’ bases changed to ‘t’. The original sequence is not modified.
s = Bio::Sequence::NA.new('augc') puts s.dna #=> 'atgc' puts s #=> 'augc'
Returns: | new Bio::Sequence::NA object |
# File lib/bio/sequence/na.rb, line 425 425: def dna 426: self.tr('u', 't') 427: end
Changes any ‘u’ bases in the original sequence to ‘t’. The original sequence is modified.
s = Bio::Sequence::NA.new('augc') puts s.dna! #=> 'atgc' puts s #=> 'atgc'
Returns: | current Bio::Sequence::NA object (modified) |
# File lib/bio/sequence/na.rb, line 437 437: def dna! 438: self.tr!('u', 't') 439: end
Returns a new complementary sequence object (without reversing). The original sequence object is not modified.
s = Bio::Sequence::NA.new('atgc') puts s.forward_complement #=> 'tacg' puts s #=> 'atgc'
Returns: | new Bio::Sequence::NA object |
# File lib/bio/sequence/na.rb, line 102 102: def forward_complement 103: s = self.class.new(self) 104: s.forward_complement! 105: s 106: end
Converts the current sequence into its complement (without reversing). The original sequence object is modified.
seq = Bio::Sequence::NA.new('atgc') puts s.forward_complement! #=> 'tacg' puts s #=> 'tacg'
Returns: | current Bio::Sequence::NA object (modified) |
# File lib/bio/sequence/na.rb, line 116 116: def forward_complement! 117: if self.rna? 118: self.tr!('augcrymkdhvbswn', 'uacgyrkmhdbvswn') 119: else 120: self.tr!('atgcrymkdhvbswn', 'tacgyrkmhdbvswn') 121: end 122: self 123: end
Calculate the ratio of GC / ATGC bases. U is regarded as T.
s = Bio::Sequence::NA.new('atggcgtga') puts s.gc_content #=> 0.555555555555556
Returns: | Float |
# File lib/bio/sequence/na.rb, line 305 305: def gc_content 306: count = self.composition 307: at = count['a'] + count['t'] + count['u'] 308: gc = count['g'] + count['c'] 309: return 0.0 if at + gc == 0 310: return gc.quo(at + gc) 311: end
Calculate the ratio of GC / ATGC bases as a percentage rounded to the nearest whole number. U is regarded as T.
s = Bio::Sequence::NA.new('atggcgtga') puts s.gc_percent #=> 55
Returns: | Fixnum |
# File lib/bio/sequence/na.rb, line 290 290: def gc_percent 291: count = self.composition 292: at = count['a'] + count['t'] + count['u'] 293: gc = count['g'] + count['c'] 294: return 0 if at + gc == 0 295: gc = 100 * gc / (at + gc) 296: return gc 297: end
Calculate the ratio of (G - C) / (G + C) bases.
s = Bio::Sequence::NA.new('atggcgtga') puts s.gc_skew #=> 0.6
Returns: | Float |
# File lib/bio/sequence/na.rb, line 333 333: def gc_skew 334: count = self.composition 335: g = count['g'] 336: c = count['c'] 337: return 0.0 if g + c == 0 338: return (g - c).quo(g + c) 339: end
Returns an alphabetically sorted array of any non-standard bases (other than ‘atgcu’).
s = Bio::Sequence::NA.new('atgStgQccR') puts s.illegal_bases #=> ["q", "r", "s"]
Returns: | Array object |
# File lib/bio/sequence/na.rb, line 362 362: def illegal_bases 363: self.scan(/[^atgcu]/).sort.uniq 364: end
Estimate molecular weight (using the values from BioPerl‘s SeqStats.pm module).
s = Bio::Sequence::NA.new('atggcgtga') puts s.molecular_weight #=> 2841.00708
RNA and DNA do not have the same molecular weights,
s = Bio::Sequence::NA.new('auggcguga') puts s.molecular_weight #=> 2956.94708
Returns: | Float object |
# File lib/bio/sequence/na.rb, line 378 378: def molecular_weight 379: if self.rna? 380: Bio::NucleicAcid.weight(self, true) 381: else 382: Bio::NucleicAcid.weight(self) 383: end 384: end
Generate the list of the names of each nucleotide along with the sequence (full name). Names used in bioruby are found in the Bio::AminoAcid::NAMES hash.
s = Bio::Sequence::NA.new('atg') puts s.names #=> ["Adenine", "Thymine", "Guanine"]
Returns: | Array object |
# File lib/bio/sequence/na.rb, line 409 409: def names 410: array = [] 411: self.each_byte do |x| 412: array.push(Bio::NucleicAcid.names[x.chr.upcase]) 413: end 414: return array 415: end
Returns a new sequence object with the reverse complement sequence to the original. The original sequence is not modified.
s = Bio::Sequence::NA.new('atgc') puts s.reverse_complement #=> 'gcat' puts s #=> 'atgc'
Returns: | new Bio::Sequence::NA object |
# File lib/bio/sequence/na.rb, line 133 133: def reverse_complement 134: s = self.class.new(self) 135: s.reverse_complement! 136: s 137: end
Converts the original sequence into its reverse complement. The original sequence is modified.
s = Bio::Sequence::NA.new('atgc') puts s.reverse_complement #=> 'gcat' puts s #=> 'gcat'
Returns: | current Bio::Sequence::NA object (modified) |
# File lib/bio/sequence/na.rb, line 147 147: def reverse_complement! 148: self.reverse! 149: self.forward_complement! 150: end
Returns a new sequence object with any ‘t’ bases changed to ‘u’. The original sequence is not modified.
s = Bio::Sequence::NA.new('atgc') puts s.dna #=> 'augc' puts s #=> 'atgc'
Returns: | new Bio::Sequence::NA object |
# File lib/bio/sequence/na.rb, line 449 449: def rna 450: self.tr('t', 'u') 451: end
Changes any ‘t’ bases in the original sequence to ‘u’. The original sequence is modified.
s = Bio::Sequence::NA.new('atgc') puts s.dna! #=> 'augc' puts s #=> 'augc'
Returns: | current Bio::Sequence::NA object (modified) |
# File lib/bio/sequence/na.rb, line 461 461: def rna! 462: self.tr!('t', 'u') 463: end
Create a ruby regular expression instance (Regexp)
s = Bio::Sequence::NA.new('atggcgtga') puts s.to_re #=> /atggcgtga/
Returns: | Regexp object |
# File lib/bio/sequence/na.rb, line 393 393: def to_re 394: if self.rna? 395: Bio::NucleicAcid.to_re(self.dna, true) 396: else 397: Bio::NucleicAcid.to_re(self) 398: end 399: end
Translate into an amino acid sequence.
s = Bio::Sequence::NA.new('atggcgtga') puts s.translate #=> "MA*"
By default, translate starts in reading frame position 1, but you can start in either 2 or 3 as well,
puts s.translate(2) #=> "WR" puts s.translate(3) #=> "GV"
You may also translate the reverse complement in one step by using frame values of -1, -2, and -3 (or 4, 5, and 6)
puts s.translate(-1) #=> "SRH" puts s.translate(4) #=> "SRH" puts s.reverse_complement.translate(1) #=> "SRH"
The default codon table in the translate function is the Standard Eukaryotic codon table. The translate function takes either a number or a Bio::CodonTable object for its table argument. The available tables are (NCBI):
1. "Standard (Eukaryote)" 2. "Vertebrate Mitochondrial" 3. "Yeast Mitochondorial" 4. "Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma" 5. "Invertebrate Mitochondrial" 6. "Ciliate Macronuclear and Dasycladacean" 9. "Echinoderm Mitochondrial" 10. "Euplotid Nuclear" 11. "Bacteria" 12. "Alternative Yeast Nuclear" 13. "Ascidian Mitochondrial" 14. "Flatworm Mitochondrial" 15. "Blepharisma Macronuclear" 16. "Chlorophycean Mitochondrial" 21. "Trematode Mitochondrial" 22. "Scenedesmus obliquus mitochondrial" 23. "Thraustochytrium Mitochondrial"
If you are using anything other than the default table, you must specify frame in the translate method call,
puts s.translate #=> "MA*" (using defaults) puts s.translate(1,1) #=> "MA*" (same as above, but explicit) puts s.translate(1,2) #=> "MAW" (different codon table)
and using a Bio::CodonTable instance in the translate method call,
mt_table = Bio::CodonTable[2] puts s.translate(1, mt_table) #=> "MAW"
By default, any invalid or unknown codons (as could happen if the sequence contains ambiguities) will be represented by ‘X’ in the translated sequence. You may change this to any character of your choice.
s = Bio::Sequence::NA.new('atgcNNtga') puts s.translate #=> "MX*" puts s.translate(1,1,'9') #=> "M9*"
The translate method considers gaps to be unknown characters and treats them as such (i.e. does not collapse sequences prior to translation), so
s = Bio::Sequence::NA.new('atgc--tga') puts s.translate #=> "MX*"
Arguments:
Returns: | Bio::Sequence::AA object |
# File lib/bio/sequence/na.rb, line 234 234: def translate(frame = 1, table = 1, unknown = 'X') 235: if table.is_a?(Bio::CodonTable) 236: ct = table 237: else 238: ct = Bio::CodonTable[table] 239: end 240: naseq = self.dna 241: case frame 242: when 1, 2, 3 243: from = frame - 1 244: when 4, 5, 6 245: from = frame - 4 246: naseq.complement! 247: when -1, -2, -3 248: from = -1 - frame 249: naseq.complement! 250: else 251: from = 0 252: end 253: nalen = naseq.length - from 254: nalen -= nalen % 3 255: aaseq = naseq[from, nalen].gsub(/.{3}/) {|codon| ct[codon] or unknown} 256: return Bio::Sequence::AA.new(aaseq) 257: end